View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_low_50 (Length: 208)
Name: NF4163_low_50
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_low_50 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 38287151 - 38287358
Alignment:
| Q |
1 |
accatgaatgttactttcatatcatcggaccaagtcaacatccaattatcattatgttgtgcttttgagttatgtagaggtaaaaaatgcattgatcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38287151 |
accatgaatgttactttcatatcatcggaccaagtcaacatccaattatcattatgttgtgcttttgagttatgtagaggtaaaaaatgcattgatcaaa |
38287250 |
T |
 |
| Q |
101 |
cagatcccacaacaaattcgactttggttgaagtcagaaactagcaaaggcaatgcaaggaagaggtcttactcttacataggtttacactatagactat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38287251 |
cagatcccacaacaaattcgactttggttgaagtcagaaactagcaaaggcaatgcaaggaagaggtcttactcttacataggtttaaactatagactat |
38287350 |
T |
 |
| Q |
201 |
gtatcttt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
38287351 |
gtatcttt |
38287358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University