View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4163_low_51 (Length: 205)

Name: NF4163_low_51
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4163_low_51
NF4163_low_51
[»] chr6 (1 HSPs)
chr6 (127-189)||(16111214-16111276)


Alignment Details
Target: chr6 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 127 - 189
Target Start/End: Original strand, 16111214 - 16111276
Alignment:
127 tcattttctctcactgtatcttctgcaccaaattctcgctctattctataaacaaacttcttc 189  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
16111214 tcattttctctcactgtatcttctgcaccaaactctcgctctattctataaacaaacttcttc 16111276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University