View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4163_low_6 (Length: 407)
Name: NF4163_low_6
Description: NF4163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4163_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 174 - 388
Target Start/End: Original strand, 18648108 - 18648322
Alignment:
| Q |
174 |
attttctaacttggtttacaagaatgttttataaactcgacgagtgattgagcccgtaaaacctccaaattgtagttcaattagctcaaacagttgatca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18648108 |
attttctaacttggtttacaagaatgttttataaactcgacgagtgattgagcccgtaaaacctccaaattgtagttcaattagctcaaacagttgatca |
18648207 |
T |
|
| Q |
274 |
gaatgactaatgaataaataagccgtggttgtgttgcaattgcggagttttataaacagaaatgtttgcgactttgatcacaacatcagcgatatcaaag |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18648208 |
gaatgactaatgaataaataagccgtggttgtgttgcaattgcggagttttataaacagaaatgtttgcgactttgatcacaacatcagcgatatcaaag |
18648307 |
T |
|
| Q |
374 |
tatttctgtctccac |
388 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
18648308 |
tatttctgtctccac |
18648322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 11 - 137
Target Start/End: Original strand, 18645817 - 18645943
Alignment:
| Q |
11 |
cacagaaactcaacaacagaaccatcacttttttgtttaacaaagttacaggacagaatcaaagtcttgttcttgtttgttaaaacatctggttgggtga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645817 |
cacagaaactcaacaacagaaccatcacttttttgtttaacaaagttacaggacagaatcaaagtcttgttcttgtttgttaaaacatctggttgggtga |
18645916 |
T |
|
| Q |
111 |
tagaaaacattccttgtgctatggagc |
137 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
18645917 |
tagaaaacattccttgtgctatggagc |
18645943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University