View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4164_high_11 (Length: 238)
Name: NF4164_high_11
Description: NF4164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4164_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 39307549 - 39307327
Alignment:
| Q |
17 |
acgtagaagcctccatgatcgaacttgtttttgacaatctactgtggttacaccattggtcatgctgctaccaccaaccttggtgatgtaggccattgtc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39307549 |
acgtagaagcctccatgatcgaacttgtttttgacaatctactgtggttacaccattggtcatgctgctactaccaaccttggtgatgtaggccattgtc |
39307450 |
T |
 |
| Q |
117 |
atatatttgtggtaccttacttggtt-ttttctttggttttgcacttgatcttatgtatggtttgggacagtttatatagtacatgtatgtattatgatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307449 |
atatatttgtggtaccttacttggtttttttctttggttttgcacttgatcttatgtatggtttgggacagtttatatagtacatgtatgtattatgatg |
39307350 |
T |
 |
| Q |
216 |
caatagttttattctaataaagt |
238 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
39307349 |
caatagttttattttaataaagt |
39307327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University