View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4164_low_12 (Length: 251)
Name: NF4164_low_12
Description: NF4164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4164_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 98 - 243
Target Start/End: Complemental strand, 39307183 - 39307038
Alignment:
| Q |
98 |
gtacaatgctagctatgagagcacccatggtgctatcaggtaaggtgataatagcatatgcaactcatgaggttcaacttagaagtgtgatttttactga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307183 |
gtacaatgctagctatgagagcacccatggtgctatcaggtaaagtgataatagtatatgcaactcatgaggttcaacttagaagtgtgatttttactga |
39307084 |
T |
 |
| Q |
198 |
aaaatgattattatctacctttctgtcttttatttctcttcatctc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307083 |
aaaatgattattatctacctttctgtcttttatttctcttcatctc |
39307038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University