View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4164_low_16 (Length: 220)
Name: NF4164_low_16
Description: NF4164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4164_low_16 |
 | |
|
| [»] scaffold0015 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0015 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 34 - 205
Target Start/End: Complemental strand, 207416 - 207245
Alignment:
| Q |
34 |
caatctatcaccgtcctcttttccgtgctattattatgcaaatccaaaaacaacacaccaccgaagccgacacttacccagatccagaaaaacaattatc |
133 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
207416 |
caatctatcattgtcctcttttccgtgctattattatgcaaatccaaaaacaacacacgacccaagccgacacttacctagatccacaaaaatgattatc |
207317 |
T |
|
| Q |
134 |
ttgttgttgttactcttgaatatttcgcaaatgatgacaaagtagacatggacatcatatctccattgaaaa |
205 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| |||| | |||||||||||||||||| |||| |
|
|
| T |
207316 |
ttgttgatgttactcttgaatatttctcaaatgatgacaaaatagatagggacatcatatctccattaaaaa |
207245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 34 - 205
Target Start/End: Original strand, 21962321 - 21962492
Alignment:
| Q |
34 |
caatctatcaccgtcctcttttccgtgctattattatgcaaatccaaaaacaacacaccaccgaagccgacacttacccagatccagaaaaacaattatc |
133 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
21962321 |
caatctatcattgtcctcttttccgtgctattattatgcaaatccaaaaacaacacacgacccaagccgacacttacctagatccacaaaaatgattatc |
21962420 |
T |
|
| Q |
134 |
ttgttgttgttactcttgaatatttcgcaaatgatgacaaagtagacatggacatcatatctccattgaaaa |
205 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| |||| | |||||||||||||||||| |||| |
|
|
| T |
21962421 |
ttgttgatgttactcttgaatatttctcaaatgatgacaaaatagatagggacatcatatctccattaaaaa |
21962492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 134 - 181
Target Start/End: Complemental strand, 39324441 - 39324394
Alignment:
| Q |
134 |
ttgttgttgttactcttgaatatttcgcaaatgatgacaaagtagaca |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
39324441 |
ttgttgttgttactctcgaatatttcgcaaatgatgacaaactagaca |
39324394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University