View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4164_low_7 (Length: 360)
Name: NF4164_low_7
Description: NF4164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4164_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 186 - 344
Target Start/End: Complemental strand, 21525746 - 21525587
Alignment:
| Q |
186 |
taagctactactcaacaaacatttttgataaaaaattatcatgtggaaaatgatccctataagaaataggagagttgaggtgatctcaactttgtcgaca |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21525746 |
taagctactactcaacaaacatttttgataaaaaattatcatgtggaaaatgatcactataagaaataggagagttgaggtgatctcaactttgtcgaca |
21525647 |
T |
|
| Q |
286 |
ttattatttctaacaaggatatgcagcaatacactaaaatatatt-aaataagagcattg |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21525646 |
ttattatttctaacaaggatatgcagcaatacactaaaatatattaaaataagagcattg |
21525587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 11 - 120
Target Start/End: Complemental strand, 21525920 - 21525812
Alignment:
| Q |
11 |
atgaattaccttttactatgtatatttgttacaacgtgtactagtgtgttgttgtgaaactcgattttctttctttcaaatcttccttctccgacaagca |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
21525920 |
atgaattaccttttactatgcatatttgttacaacgtgtacttgtgtgttgttgtgaaactcgattttctttctttcaacccttccttctccgac-agca |
21525822 |
T |
|
| Q |
111 |
tttttatggg |
120 |
Q |
| |
|
|||||||||| |
|
|
| T |
21525821 |
tttttatggg |
21525812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University