View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4165_high_1 (Length: 401)
Name: NF4165_high_1
Description: NF4165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4165_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 90 - 217
Target Start/End: Original strand, 1411562 - 1411690
Alignment:
| Q |
90 |
aaaagattgttgtgtatgtggcaagg-cttcaaagactagtgccctcaatgaacaattatggtgagaacaccactgatcaagtgatcattgagaaaataa |
188 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1411562 |
aaaagattgttgtgtatgtggcaagggcttcaaacactagtgccctcaatgaacaattatggtgagaacaccactgatcaagtgatcaatgagaaaataa |
1411661 |
T |
 |
| Q |
189 |
ggaggaaactgacacctcttttcgatcat |
217 |
Q |
| |
|
|||||| | |||||||||||||||||||| |
|
|
| T |
1411662 |
ggaggacaatgacacctcttttcgatcat |
1411690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 11 - 64
Target Start/End: Original strand, 1411509 - 1411562
Alignment:
| Q |
11 |
tgaaagtggtgacaaagtcaagaaagggaaattgcaataacttagaagacaata |
64 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1411509 |
tgaacgtggtgacaaagtcaagaaagggaaattgcaataacttagaagacaata |
1411562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University