View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4165_high_7 (Length: 233)
Name: NF4165_high_7
Description: NF4165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4165_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 100 - 222
Target Start/End: Original strand, 3961192 - 3961314
Alignment:
| Q |
100 |
aaaaaactgttacaaaggaacattaaactcactgtaaggtcaactgatgttacttcttccttctactagacagtacaggtcaagaggatgaagtttcaac |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
3961192 |
aaaaaactgttacaaaggaccattaaactcactgtaaggtcaactgatgttacttcttccttctactagacagcacaggtcaagaggaagaagtttcaac |
3961291 |
T |
 |
| Q |
200 |
atataggagcaagagtattatct |
222 |
Q |
| |
|
|||||||| ||||||||| |||| |
|
|
| T |
3961292 |
atataggaacaagagtataatct |
3961314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 3961103 - 3961163
Alignment:
| Q |
18 |
gagagaaagttgaaacagatctctagcagccaaatcattgaaggttggtaattgcttccaa |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3961103 |
gagagaaagttgaaacagatctctagcagccaaatcattgaaggttagtaattgcttccaa |
3961163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 124 - 222
Target Start/End: Complemental strand, 3806575 - 3806474
Alignment:
| Q |
124 |
aaactcactgtaaggtcaactgatgttacttcttcct---tctactagacagtacaggtcaagaggatgaagtttcaacatataggagcaagagtattat |
220 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||| |||| |||||| |||||||||||| | ||||||||||||||||||||| |||||||| || |
|
|
| T |
3806575 |
aaactcacggtaaggtcaactgaaatgacttcttcctccttctattagacaatacaggtcaagaaggtgaagtttcaacatataggagaaagagtataat |
3806476 |
T |
 |
| Q |
221 |
ct |
222 |
Q |
| |
|
|| |
|
|
| T |
3806475 |
ct |
3806474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 124 - 222
Target Start/End: Complemental strand, 3813218 - 3813117
Alignment:
| Q |
124 |
aaactcactgtaaggtcaactgatgttacttcttcct---tctactagacagtacaggtcaagaggatgaagtttcaacatataggagcaagagtattat |
220 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||| |||| |||||| |||||||||||| | ||||||||||||||||||||| |||||||| || |
|
|
| T |
3813218 |
aaactcacggtaaggtcaactgaaatgacttcttcctccttctattagacaatacaggtcaagaaggtgaagtttcaacatataggagaaagagtataat |
3813119 |
T |
 |
| Q |
221 |
ct |
222 |
Q |
| |
|
|| |
|
|
| T |
3813118 |
ct |
3813117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 3950877 - 3950919
Alignment:
| Q |
20 |
gagaaagttgaaacagatctctagcagccaaatcattgaaggt |
62 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3950877 |
gagaaagttgaatcagatctctagcagccaaaacattgaaggt |
3950919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 4014380 - 4014324
Alignment:
| Q |
18 |
gagagaaagttgaaacagatctctagcagccaaatcattgaaggttggtaattgctt |
74 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||| ||| ||||||||||| | |||||||| |
|
|
| T |
4014380 |
gagagaaacttgaatcagatctatagcagctaaagcattgaaggtttgaaattgctt |
4014324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 74
Target Start/End: Complemental strand, 4027999 - 4027947
Alignment:
| Q |
22 |
gaaagttgaaacagatctctagcagccaaatcattgaaggttggtaattgctt |
74 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
4027999 |
gaaagtcgaatcagatctctagcagccaaagcattcaaggtcagtaattgctt |
4027947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University