View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4165_high_8 (Length: 215)
Name: NF4165_high_8
Description: NF4165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4165_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 28666997 - 28667175
Alignment:
| Q |
18 |
attgcagccatgttaatactgtttatatggtgttacaaaggctgatccacaacctcactct--atcgaattcacgtggacacaaacacagaatctgcgca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28666997 |
attgcagccatgttaatactgtttatatggtgttacaaaggctaatccacaacttcactctctatcaaattcacgtggacacaaacacagaatctgcgca |
28667096 |
T |
 |
| Q |
116 |
gggctttggctgggagctgttacctcgtgctagctagggtcatggtgttttcttgcccatggccttgggtggcagaatcta |
196 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28667097 |
gggctttg--tgggagctgtatcctcgcgctagctagggtcatggtgttttcttgcccatggccttgggtggaagaatcta |
28667175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University