View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4165_low_9 (Length: 243)
Name: NF4165_low_9
Description: NF4165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4165_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 8953879 - 8954111
Alignment:
| Q |
1 |
tccaatgttgacttcctttccgacttagacataatcagttggctcaaagagggtctatcttcgatcaactccaacacttttgccgcaactatatggtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8953879 |
tccaatgttgacttcctttccgacttagacgtaatctgttggctcaaagagggtctatcttcgatcaactccaacacttttgccgcaactatatggtgga |
8953978 |
T |
|
| Q |
101 |
cttggcttaatcacaattatttttgcttttccaactcatctatccttctatattgtttcactatgtaaactcgtgatatgacttccacctccatcgcttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
8953979 |
cttggcttaatcacaattatttttgctcttccaactcatctatcattctatattgtttcactatgtaagcccgtgatatgacttccacctccatcgcttg |
8954078 |
T |
|
| Q |
201 |
cttctcgagctcccagccagtaatacatgatga |
233 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
8954079 |
cttctctagctcccagccagtaatacatgatga |
8954111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 9367210 - 9367145
Alignment:
| Q |
63 |
gatcaactccaacacttttgccgcaactatatggtggacttggcttaatcacaattatttttgctt |
128 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||| |||||| |||| | ||||||||||||||||||||| |
|
|
| T |
9367210 |
gatcaagtccaacacttttgtcgcaagtatttggtggtcttgacataatcacaattatttttgctt |
9367145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University