View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4166_high_14 (Length: 341)
Name: NF4166_high_14
Description: NF4166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4166_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 328
Target Start/End: Original strand, 29830822 - 29831130
Alignment:
| Q |
17 |
aatccaacagcagcttcttcataacaatatcagctattctggctatgctatcaaggcaagccagccgtttgaaaggaaaggcaaaaacgaagaaattgct |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
29830822 |
aatctaacagcagcttcttcataacaatatcagctattctggctatgctttcaaggcaagccagacgtttaaaaggaaaggcgaaaacgaagaaattgct |
29830921 |
T |
 |
| Q |
117 |
gagtaacatgagcaacaaagctttgtcacaattcgggaagatgaagaagacgaagaaacaaagagataatgaattaattaacggcggtgtttggcagaag |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
29830922 |
gagcaacatgagcaacaaagctttgtcacaattcgggaagatgaagaagacgaagaaacaaagagataatgaatta---aacgacggtgtttggcagaag |
29831018 |
T |
 |
| Q |
217 |
gagatattgatgggaggaaagtgtgagccgttggatttctccggcgttattcattatgatattaacggaagacaaaccggtgaagttcctctcaggtctc |
316 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29831019 |
gagatattgatgggaggaaaatgtgagccgttggatttctcaggcgttattcattatgatattaacggaagacaaaccggtgaagttcctctcaggtctc |
29831118 |
T |
 |
| Q |
317 |
cacgcgctattc |
328 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29831119 |
cacgcgctattc |
29831130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 196 - 325
Target Start/End: Complemental strand, 46221368 - 46221239
Alignment:
| Q |
196 |
aacggcggtgtttggcagaaggagatattgatgggaggaaagtgtgagccgttggatttctccggcgttattcattatgatattaacggaagacaaaccg |
295 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||| | || ||||||||||| | ||| || |
|
|
| T |
46221368 |
aacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacagacgc |
46221269 |
T |
 |
| Q |
296 |
gtgaagttcctctcaggtctccacgcgcta |
325 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
46221268 |
gtgaagttccgatcaggtctccacgcgcta |
46221239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University