View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4166_high_23 (Length: 262)
Name: NF4166_high_23
Description: NF4166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4166_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 41081063 - 41080827
Alignment:
| Q |
18 |
agtattggtcttgatgagtgcaagtttttcctcaaagctgttgtcaactcaggcattggtgaggaaacttatgctccaagaaacttcatcgaaggccgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41081063 |
agtattggtcttgatgagtgcaagttcttcctcaaagctgttgtcaactcaggcattggtgaggaaacttatgctccaagaaacttcatcgaaggccgaa |
41080964 |
T |
 |
| Q |
118 |
ctgtgaaccctacgttggaagacggagtggaggagatggaagagttttgtaatgatagcattgcaaagcttctaaacaaatcaggcatttcaccttcgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41080963 |
ctgtgaaccctacgttggaagacggagtggaggagatggaagagttttgtaatgatagcattacaaagcttctaaataaatcaggcatttcaccttcgga |
41080864 |
T |
 |
| Q |
218 |
gatcgatattcttgtggtaaatgtatctttattctct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41080863 |
gatcgatattcttgtggtaaatgtatctttattctct |
41080827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University