View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4166_low_21 (Length: 277)
Name: NF4166_low_21
Description: NF4166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4166_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 164 - 258
Target Start/End: Complemental strand, 33157410 - 33157316
Alignment:
| Q |
164 |
cctggtactgtcggctaaggaaacatacacactggaccaaaatacctttagctnnnnnnnncatcaatatcccttttaatacttgacctatacat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33157410 |
cctggtactgtcggctaaggaaacatacacactggaccaaaatacctttagctaaaaaaaccatcaatatcccttttaatacttgacctatacat |
33157316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 23281955 - 23281927
Alignment:
| Q |
1 |
taccaactgagttaaactcacgggaaaag |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23281955 |
taccaactgagttaaactcacgggaaaag |
23281927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University