View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4166_low_35 (Length: 236)
Name: NF4166_low_35
Description: NF4166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4166_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 42823136 - 42823240
Alignment:
| Q |
1 |
tcattgatgatttgatttctttcttctgtatatggtaataatgacagcatatatcagtaaagacagtaactaaaagacaaagactatgcagtctaggtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42823136 |
tcattgatgatttgatttctttcttctgtatatggtaataatgacagcatatatcagtaaagacagtaactaaaagacaaagactatgcagtctaggtgt |
42823235 |
T |
|
| Q |
101 |
caaaa |
105 |
Q |
| |
|
||||| |
|
|
| T |
42823236 |
caaaa |
42823240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 147 - 219
Target Start/End: Original strand, 42823292 - 42823364
Alignment:
| Q |
147 |
ggtgtatagactcaaaatgggtgctgttattctgaacaaatagagaaccaaatatagcagcacccttttagat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42823292 |
ggtgtatagactcaaaatgggtgctgttattctgaacaaatagagaaccaaatatagcagcacccttttagat |
42823364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University