View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4166_low_36 (Length: 235)
Name: NF4166_low_36
Description: NF4166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4166_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 21252920 - 21252697
Alignment:
| Q |
1 |
gcggatcttattgctcatcggcagctgagt----catttcaggccagcagcatttattgaagattgatcaacaggaaatcgaacattcatgttttacatc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21252920 |
gcggatcttattgctcatcggcagctgagtacggcatttcaggccagcagcatttattgaagattgatcaacaggaaatcgaacattcatgttttacatc |
21252821 |
T |
|
| Q |
97 |
atccgaatcaaatctgaagtatttgttagaaactgtccaaataaaattactagaatatacatattgacattgatctcgccacataaaaatattatctact |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21252820 |
atccgaatcaaatctgaagtatttgttagaaactgtccaaata----------aatatacatattgacattgatctccccacataaaaatattatctact |
21252731 |
T |
|
| Q |
197 |
ggtgtgttatttgattctttgatgttgatgatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21252730 |
ggtgtgttatttgattctttgatgttgatgatgt |
21252697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University