View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4166_low_37 (Length: 233)
Name: NF4166_low_37
Description: NF4166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4166_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 33584386 - 33584546
Alignment:
| Q |
18 |
cagaaggcttagcttgatgacagtagttccggattgaatttatcatttggtgttgtcaaattgatggatgaggggattgaatttttgtttgtaatgtagg |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33584386 |
cagaaggcttggcttgatgacagtagtttcagattgaatttatcatttggtgttgtaaaattgatggatgaggggattgaatttttgtttgtaatgtagg |
33584485 |
T |
|
| Q |
118 |
aattttaggtgttgtgttgcttcggtgggtggattgttttctttttcctttgtactatttg |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33584486 |
aattttaggtgctgtgttgcttcggtgggtggattgttttctttttcctttgtactgtttg |
33584546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Complemental strand, 15259643 - 15259611
Alignment:
| Q |
120 |
ttttaggtgttgtgttgcttcggtgggtggatt |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15259643 |
ttttaggtgttgtgttgcttcggtgggtggatt |
15259611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 13937818 - 13937850
Alignment:
| Q |
120 |
ttttaggtgttgtgttgcttcggtgggtggatt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
13937818 |
ttttaggtgttgtgttgcttcggtgggttgatt |
13937850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University