View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4166_low_40 (Length: 227)
Name: NF4166_low_40
Description: NF4166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4166_low_40 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 41842077 - 41841868
Alignment:
| Q |
18 |
agaattactatgaagattatttagctaaaatgagaggaactcaaagtgaaaggatgaagatcttataccattcctcatttcctccttatggctccagtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41842077 |
agaattactatgaagattatttagctaaaatgagaggaactcaaagtgaaaggatgaagatcttataccattcctcatttcctccttatggctccagtag |
41841978 |
T |
 |
| Q |
118 |
cttcgtatcggcagattctatggggtggaattccatggtttatgtatgtaatgtaatcaaaaactaaaacaagcacacggtcagaatgaaatgaagtatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41841977 |
cttcgtatcggcagattctatggggtggaattccaacgtttatgtatgtaatgtaatcaaaaactaaaacaagcacacggtcagaatgaaatgaagtatt |
41841878 |
T |
 |
| Q |
218 |
atgcattgct |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
41841877 |
atgcattgct |
41841868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 85
Target Start/End: Original strand, 42090403 - 42090453
Alignment:
| Q |
35 |
tatttagctaaaatgagaggaactcaaagtgaaaggatgaagatcttatac |
85 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
42090403 |
tatttagctaaaataggaggtactcaaagtgaaaggatgaagatcttatac |
42090453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University