View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_high_11 (Length: 341)
Name: NF4167_high_11
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 320
Target Start/End: Complemental strand, 53250889 - 53250577
Alignment:
| Q |
18 |
caaagatgggaacgggtagctgcagctgtaactgggaagattgttggtcagtgcaagaaaaaattcgccatgatgaaggaaagtttcaggaacaagaaag |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53250889 |
caaagatgggaacgggttgctgcagctgtaactgggaagattgttggtcagtgcaagaaaaaattcgccatgatgaaggaaagtttcaggaacaagaaag |
53250790 |
T |
 |
| Q |
118 |
cggctgtttgatttatcattcataacacatctatccatggaattatgaaaatagatgttgcatcaatctgatgggtatgcaatttctcaagtaatttata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53250789 |
cggctgtttgatttatcattcataacacatctatccatggaattatgaaaatagatgttgcatcaatctgatgggtatgcaatttctcaagtaatttata |
53250690 |
T |
 |
| Q |
218 |
cttcacaccgtagtttgatctatggaatacatttacttatttatttgtcttgattatttagacctaacaga----------atactccatcctgatctct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53250689 |
cttcacaccgtagtttgatctatggaatacatttacttatctatttgtcttgattatttagacctaacagaatatgggctgatactccatcctgatctct |
53250590 |
T |
 |
| Q |
308 |
accattattatag |
320 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53250589 |
accattattatag |
53250577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 21 - 138
Target Start/End: Complemental strand, 53236456 - 53236339
Alignment:
| Q |
21 |
agatgggaacgggtagctgcagctgtaactgggaagattgttggtcagtgcaagaaaaaattcgccatgatgaaggaaagtttcaggaacaagaaagcgg |
120 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| || ||||||||||||||||| |||||||||||||||| |||||||||||||||| | | |
|
|
| T |
53236456 |
agatgggaacgagtagctgcagctgtacctgggaagaccgtgatccagtgcaagaaaaaatttgccatgatgaaggaaaatttcaggaacaagaaaactg |
53236357 |
T |
 |
| Q |
121 |
ctgtttgatttatcattc |
138 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
53236356 |
cagtttgatttatcattc |
53236339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 21 - 138
Target Start/End: Complemental strand, 44740540 - 44740423
Alignment:
| Q |
21 |
agatgggaacgggtagctgcagctgtaactgggaagattgttggtcagtgcaagaaaaaattcgccatgatgaaggaaagtttcaggaacaagaaagcgg |
120 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| || ||||||||||||||||| ||| |||||||||||| |||||||||||||||| | | |
|
|
| T |
44740540 |
agatgggaacgagtagctgcagctgtacctgggaagaccgtgatccagtgcaagaaaaaatttgccgtgatgaaggaaaatttcaggaacaagaaaactg |
44740441 |
T |
 |
| Q |
121 |
ctgtttgatttatcattc |
138 |
Q |
| |
|
| ||||||| ||| |||| |
|
|
| T |
44740440 |
cagtttgatatattattc |
44740423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University