View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_high_22 (Length: 258)
Name: NF4167_high_22
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 133 - 242
Target Start/End: Complemental strand, 43331173 - 43331069
Alignment:
| Q |
133 |
ggccggctttgtaaaataacccaaagttgaagcgtgaaggcattagacttgcatgtgtatgattgttagttatttctttggtgtagtttcaaacgggagc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
43331173 |
ggccggctttgtaaaataacccaaagttgaagcgtgaaggcattagacttgcatgtgtatgattttta-----ttctttggtgtagtttcaaacgggagc |
43331079 |
T |
|
| Q |
233 |
accaagagac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
43331078 |
accaagagac |
43331069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 35
Target Start/End: Complemental strand, 43331287 - 43331257
Alignment:
| Q |
5 |
acatcatcaaaattcaaacggctcctagagc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43331287 |
acatcatcaaaattcaaacggctcctagagc |
43331257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University