View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_high_33 (Length: 214)
Name: NF4167_high_33
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_high_33 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 38523882 - 38524095
Alignment:
| Q |
1 |
tcttcagattgttgaatgtttctgagatgctaatcgcttcaatactcctggtagcactagcagacaccgaagtgtatcttttaattgagattattgtagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38523882 |
tcttcagattgttgaatgtttctgagatgctaatcgcttcaatactcctggtagcactagcagacaccgaagtgtatcttttaattgagattattgtagc |
38523981 |
T |
|
| Q |
101 |
attcttggaggaaacaccgacccgaaaaccggtttcaggtttcttcaattgcaagaagcaatgtgatttcaatgcaatggccatgagaacaatttgtctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38523982 |
attcttggaggaaacaccgacccgaaaaccggtttcaggtttcttcaattgcaacaagcaatgtgatttcaatgcaatggccatgagaacaatttgtctt |
38524081 |
T |
|
| Q |
201 |
caatatcctacaga |
214 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
38524082 |
caatattctacaga |
38524095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University