View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_high_34 (Length: 212)
Name: NF4167_high_34
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 49
Target Start/End: Complemental strand, 30168446 - 30168411
Alignment:
| Q |
14 |
gagaagaaaaagacacgtaggacttccaaaattggg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30168446 |
gagaagaaaaagacacgtaggacttccaaaattggg |
30168411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 122
Target Start/End: Complemental strand, 43245428 - 43245384
Alignment:
| Q |
78 |
tgcatttcttgcttgtttcatttgtaaatttcagcatttcccttt |
122 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
43245428 |
tgcatttcttgcttgttacattcgtaaatttcagcattttccttt |
43245384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University