View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_15 (Length: 331)
Name: NF4167_low_15
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 41 - 316
Target Start/End: Complemental strand, 8082327 - 8082053
Alignment:
| Q |
41 |
ttctacacacaaatctaatttgagatcttctaaacgattcatgatttaatagattgatagggattgtgtaaagagttcttttaaacgattcgtgatttaa |
140 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8082327 |
ttcttcacacaaatctaatttgagttcttctaaacgattcatgatttaatagattgatagggattgtgtaaagagttcttctaaacgattcgtgatttaa |
8082228 |
T |
 |
| Q |
141 |
aagattgataggggttgtgtaaagtaagattagtgtttgggctttcacttcatcttcacgaataagaccagaaagcccataatcgattctagtggctaca |
240 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8082227 |
tagattgattggggttgtgtaaagtaa-attagtgtttgggctttcacttcatcttcacgaataagaccaaaaagcccataatcgattctagtggctaca |
8082129 |
T |
 |
| Q |
241 |
acgctagaagcgttaagcctttttcgttcccaaacacctcccaagtcccaattgactcttcttcaatcaccaactt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8082128 |
acgctagaagcgttaagcctttttcgttcccaaacacctcccaagtcccaattgactcttcttcaatcaccaactt |
8082053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University