View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_25 (Length: 270)
Name: NF4167_low_25
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 249010 - 248773
Alignment:
| Q |
14 |
acagacagagagggagcatacaaattagatataccatcagtggatggaactaactgtaaaattgccatggatggtaattcacagattgtgtctctctgcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249010 |
acagacagagagggagcatacaaattagatataccatcagtggatggaactaactgtaaaattgccatggatggtaattcacagattgtgtctctctgcc |
248911 |
T |
|
| Q |
114 |
aagcaaccttgataggaacttcatcatcttcttattcttgcaatgttcctttcttgaagagcacaggaagtagtcagatattaaaacaagagaataacct |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
248910 |
aagcaagcttgataggaacttcatcatcttcttattcttgcaatgttcctttcttgaagagcacaggaagtagtcagatattaaaacaagagaataacct |
248811 |
T |
|
| Q |
214 |
atgtgtatacagcttgggagctcttagttacaagccac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
248810 |
atgtgtatacagcttgggagctcttagttacaagccac |
248773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University