View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_27 (Length: 262)
Name: NF4167_low_27
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 118 - 206
Target Start/End: Original strand, 26039248 - 26039336
Alignment:
| Q |
118 |
tacaaatctaaatgtatctctatttttctaaactagacaatgacccctttcataaacattaatagataccattctacagatatcctagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26039248 |
tacaaatctaaatgtatctctatttttctaaactagacaatgacccatttcgtaaacattaatagataccattctacagatatcctagc |
26039336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 94 - 174
Target Start/End: Original strand, 36161150 - 36161230
Alignment:
| Q |
94 |
cctttttattaaccaattgtctcgtacaaatctaaatgtatctctatttttctaaactagacaatgacccctttcataaac |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161150 |
cctttttattaaccaattgtctcgtacaaatctaaatatatctctatttttctaaactagacaatgacccctttcataaac |
36161230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 192
Target Start/End: Complemental strand, 38146817 - 38146743
Alignment:
| Q |
119 |
acaaatctaaatgtatctctatttttctaaactagacaatgacccctttcataa-acattaatagataccattct |
192 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||| ||||||||||| ||||| | ||| ||| |||||||||| |
|
|
| T |
38146817 |
acaaacctagatgtatctttatttttctaaactagataatgaccccttccataacaaattcataaataccattct |
38146743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University