View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_31 (Length: 238)
Name: NF4167_low_31
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 51406425 - 51406644
Alignment:
| Q |
19 |
ggacactcactgaagtaagaattgcggtacacctgctcttttgttaccttctccggccatatcctgttgaaaa-ttatgatgttgttgatgcacaccaac |
117 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51406425 |
ggacactcactgaagtaaga-tcgcggtacacctgctcttttgttaccttctccggccatatcctgttgaaaaattatgatgttgttgatgcacaccaac |
51406523 |
T |
 |
| Q |
118 |
atctcatatttgtaagggattaaattgcggtatttaactgttccatgcgttctgctttcatggttctcatttttggcctcccaattcgtgcacttagaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51406524 |
atctcatatttgtaagggattaaattgcggtatttaactgttccatgcgttctgctttcatggttctcatttttggcctcccaattcgtgcacttagaaa |
51406623 |
T |
 |
| Q |
218 |
gaaatgaagttttttgtgtct |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51406624 |
gaaatgaagttttttgtgtct |
51406644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University