View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_33 (Length: 238)
Name: NF4167_low_33
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 28309438 - 28309297
Alignment:
| Q |
1 |
tgaaactgaaatataatttataatctgtgacaannnnnnn--aaagtgacttatatattagaatgaatggagtagaataatattcaaattattcaccata |
98 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28309438 |
tgaaactgatatataatttataatctgtgacaatttttttttaaagtgacttatatattagaatgaatggagtagaataatattcaaattcttcaccata |
28309339 |
T |
|
| Q |
99 |
acctcactttacaatgaataatggtgtacaaatcacattttt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28309338 |
acctcactttacaatgaataatggtgtacaaatcacattttt |
28309297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 135 - 226
Target Start/End: Complemental strand, 28309206 - 28309112
Alignment:
| Q |
135 |
atttttcaagtacgaatatgaaaattccccttaataaaaat---gtactattaatagcattcctaggtatgaacaatacaacccttcttctgatg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | | || |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28309206 |
atttttcaagtacgaatatgaaaattccccttaattgtagttttgtgctattaatagcattcctaggtatgaacagtacaacccttcttctgatg |
28309112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University