View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_35 (Length: 235)
Name: NF4167_low_35
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_35 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 14777256 - 14777037
Alignment:
| Q |
16 |
ccttcaacttatatgtaggtttaactttgtagtccatgcataccttaagatcgtttttgctcgaacgaattctcctttattattccatcagcacatgaca |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14777256 |
ccttcaacttatatgtaggtttaacattgtagtccatgcatactttaagatcgttttggctcgaacgaattctcctttattattccatcagcacatgaca |
14777157 |
T |
 |
| Q |
116 |
ataccataattcttttgtagttgcaacatttgagcaccaatgtcacgattcacggtatctctgatattatttgctgctattgcatctaatatgaataacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14777156 |
ataccataattcttttgtagttgcaacatttgagcaccaatgtcacgattcacgatatctctgatattatttgctgctattgcatctaatatgaataacc |
14777057 |
T |
 |
| Q |
216 |
atccactcgttgatgtactc |
235 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
14777056 |
atccacttgttgatgtactc |
14777037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University