View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_37 (Length: 228)
Name: NF4167_low_37
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 56 - 228
Target Start/End: Complemental strand, 2209397 - 2209213
Alignment:
| Q |
56 |
ataagagatctagaacactcagatcagaaccaaagaaaata-gtagcaaacaagtaagcaaaaatgaaagagagcaaagtgaaa---ggtgaaacaatgt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2209397 |
ataagagatctagaacactcagatcagaaccaaaaaaaaaaagtagcaaacaagtaagcaaaaatgaaagagagcaaagtgaaaggtggtgaaacaatgt |
2209298 |
T |
 |
| Q |
152 |
atgtagtg--------gttttttacaaaagaagaagaccttcctcccttttataggagagcaacataggataccaaaaatttgct |
228 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2209297 |
atgtagtggtttttttgttttttacaaaataagaagaccttccacccttttataggagagcaacataggataccaaaaatttgct |
2209213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University