View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4167_low_39 (Length: 215)
Name: NF4167_low_39
Description: NF4167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4167_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 100 - 200
Target Start/End: Complemental strand, 49302477 - 49302377
Alignment:
| Q |
100 |
gaatttttctatagactgttgatacgcaaccaaacatcatgtacctaaaaattgacaatatgttttccttaatacaaaaatttatgcctcatcaatctct |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302477 |
gaatttttctatagactattgatacgcaaccaaacatcatgtacctaaaaattgacaatatgttttccttaatacaaaaatttatgcctcatcaatctct |
49302378 |
T |
 |
| Q |
200 |
g |
200 |
Q |
| |
|
| |
|
|
| T |
49302377 |
g |
49302377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 49302557 - 49302506
Alignment:
| Q |
20 |
ggatatgtatccatcatccacttatttcttatatttttggattaacttattt |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302557 |
ggatatgtatccatcatccacttatttcttatatttttggattaacttattt |
49302506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University