View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_high_13 (Length: 373)
Name: NF4168_high_13
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 56 - 363
Target Start/End: Complemental strand, 47847974 - 47847667
Alignment:
| Q |
56 |
actggctcagaatagttgaataaacttgaaagaaccttgtttgtatttggatattctgtttcaatgttgttttctaagccaaagattggtttactattta |
155 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47847974 |
actggctcagaatagttgaatgaacttgaaagaaccttgtttgtatttggatattctgtttcaatgttgttttctaagccaaagattggtttactattta |
47847875 |
T |
|
| Q |
156 |
gttagttgacttatgcattttcatggttgttctgaatcttttgattatcctgattgggttgtttcaaatatattgtcatctcttttatgtgtactgaagt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47847874 |
gttagttgacttatgcattttcatggttgttctgaatcttctgattatcctgattgggttgtttcaaatatattgtcatctcttttatgtgtactgaagt |
47847775 |
T |
|
| Q |
256 |
gtttttaaagaatttttaccctgtttttcctttcaaattttcagttgcaaaacctctagttgtggatggcagtgcaaagtcgcatgaactgtttcttgct |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47847774 |
gtttttaaagaatttttaccctgtttttcctttcaaattttcagttgcaaaacctctagttgtggatggcagtgcaaagtcgcatgaactgtttcttgct |
47847675 |
T |
|
| Q |
356 |
tatgatga |
363 |
Q |
| |
|
|||||||| |
|
|
| T |
47847674 |
tatgatga |
47847667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 292 - 363
Target Start/End: Original strand, 386749 - 386820
Alignment:
| Q |
292 |
attttcagttgcaaaacctctagttgtggatggcagtgcaaagtcgcatgaactgtttcttgcttatgatga |
363 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||||| |||||| ||| ||||||||||||| |
|
|
| T |
386749 |
attttcagttgcaaaaccattagttgtggatgggagtgctaagtcacatgaattgtgcattgcttatgatga |
386820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University