View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_high_22 (Length: 262)
Name: NF4168_high_22
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 106 - 251
Target Start/End: Complemental strand, 4893466 - 4893322
Alignment:
| Q |
106 |
aattgattttgcatctaaaattgattttaaatagaggttaggatttatagcttttgagtctaaatgtgatcnnnnnnncacttaaatttgttgttcaaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4893466 |
aattgattttgcatctaaaattgattttaaatagaggttaggatttatagcttttgagtctaaatgtgatctttttttcacttaaatttgttgttcaaat |
4893367 |
T |
 |
| Q |
206 |
caattctatataaatgtattaaaaacataaatcactttacattcat |
251 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4893366 |
caatt-tatgtaaatgtattaaaaacataaatcactttacattcat |
4893322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 22 - 105
Target Start/End: Complemental strand, 4893577 - 4893494
Alignment:
| Q |
22 |
ttgcaccaattaattcacatcatatgaatatgaattgctgacatgactatttaggtttggtttcatgtttagagtaactagagt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4893577 |
ttgcaccaattaattcacatcatatgaatatgaattgctaacatgactatttaggtttggtttcatgtttagagcaactagagt |
4893494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University