View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_high_32 (Length: 230)
Name: NF4168_high_32
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 12286575 - 12286383
Alignment:
| Q |
19 |
agatcgacgccttggagagtgagagtttggatggcgtcctgaagagcttcggtggggtccatttcaaggtcgttgatgttttcgaagactagatcgttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12286575 |
agatcgacgccttggagagtgagagtttggatggcgtcctgaagagcttcggtggggtccatttcaaggtcgttgatgttttcgaagactagatcgttaa |
12286476 |
T |
|
| Q |
119 |
atgcttcttgtgagatcgcacgcgccgtcgtctttggtacacccattctgctgccttcagtttcagacgattttctttctctctttagctttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
12286475 |
atgcttcttgtgagatcgcacgcgccgtcgtctttggtacacccattctgctgccttcagtttcagacgattttctttttctttttagctttt |
12286383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University