View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_high_33 (Length: 226)
Name: NF4168_high_33
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 2102703 - 2102514
Alignment:
| Q |
16 |
atgaatcaacctggtaagtctcttggagtggttggtcttggtggcctcggtcatatggcagtaaaatttgggaaggcatttggtttgcgtgtaacggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2102703 |
atgaatcaacctggtaagtctcttggagtggttggtcttggtggcctcggtcatatggcagtaaaatttgggaaggcatttggtttgcgtgtaacggttt |
2102604 |
T |
 |
| Q |
116 |
tcagcactagtatgtcaaagaaagaggaggcgctgagctttcttggtgcagaccaatttgttgtttcatctaatcaagaagagatgaggg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2102603 |
tcagcactagtatgtcaaagaaagaggaggcgctgagctttcttggtgcagaccaatttgttgtttcatctaatcaagaagagatgaggg |
2102514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 2096491 - 2096300
Alignment:
| Q |
16 |
atgaatcaacctggtaagtctcttggagtggttggtcttggtggcctcggtcatatggcagtaaaatttgggaaggcatttggtttgcgtgtaacggttt |
115 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096491 |
atgaatcaacccggcaagtctcttggagtggttggtcttggtggcctcggtcatatggcggtaaaatttgggaaggcatttggtttgcgtgtaacggttt |
2096392 |
T |
 |
| Q |
116 |
tcagcactagtatgtcaaagaaagaggaggcgctgagctttcttggtgcagaccaatttgttgtttcatctaatcaagaagagatgagggta |
207 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2096391 |
tcagcactagcatgtcaaagaaagaggaggcgctgagccttcttggtgcagaccaatttgttgtttcatctaatcaagaagatatgagggta |
2096300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University