View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_low_13 (Length: 391)
Name: NF4168_low_13
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 4e-97; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 170 - 379
Target Start/End: Original strand, 43584431 - 43584636
Alignment:
| Q |
170 |
gcaaatatattcaaacctaaatcattattttataatcaattcattattaaataaaatcaattttaccgaataaatttagtagaaatcaatttttgctatc |
269 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43584431 |
gcaaatatattcaaacctaaatcatt---ttataatcaattcattattaa-taaaatcaattttactaaataaatttagtagaaatcaatttttgctatc |
43584526 |
T |
|
| Q |
270 |
acataaccaatcatgcactaagaatatgagaccaatatataatattactttaattgattgaaaagcctgaccctatggtttagacctaagctgtatattc |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43584527 |
acataaccaatcatgcactaagaatatgagaccaatatataatattactttaattgattgaaaagcctgaccctatggtttagacctaagctgtatattc |
43584626 |
T |
|
| Q |
370 |
ttacctcttc |
379 |
Q |
| |
|
|||||||||| |
|
|
| T |
43584627 |
ttacctcttc |
43584636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 43584268 - 43584356
Alignment:
| Q |
1 |
tgtttgtcattgtttatgatgaagtctgtgtttggagcattcaggattacttttgtatgtatctataaaattgattttgataggtttga |
89 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43584268 |
tgtttgtcattgtttatgatgaagtatgtgtttggagcattcaggattacttttgtatgtatctataaaattgattttgatagatttga |
43584356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 43584207 - 43584254
Alignment:
| Q |
1 |
tgtttgtcattgtttatgatgaagtctgtgtttggagcattcaggatt |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
43584207 |
tgtttgtcattgtttatgatgaagcctgtgtttggagcagtcaagatt |
43584254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University