View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_low_23 (Length: 284)
Name: NF4168_low_23
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 12 - 269
Target Start/End: Original strand, 2626325 - 2626582
Alignment:
| Q |
12 |
tgaatataattggcgaatgatctccagaaaatgattttaatcttgctgactcttttggcataagaggtgttatacttatatcaccatcacaatttctttg |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2626325 |
tgaatataattggcgaacgatctccagaaaatgattttaatcttgctgactcttttggcttaagaggtgttatacttatatcaccatcacaacttctttg |
2626424 |
T |
|
| Q |
112 |
cagcctctcctggtaaacagaagagctagatcttaatacagattttacttttgttgcactggcattagcctcaagattatcagaatggaagccagatgct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2626425 |
cagcctctcctggtaaacagaagagctagatcttaatacagattttacttttgttgcactggcattagcctcaagattatcagaatggaagccagacgct |
2626524 |
T |
|
| Q |
212 |
aaactaggagatgattcacatgtaaaagactgttggaacatcaagttttgaaatcttt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2626525 |
aaactaggagatgattcacatgtaaaagactgttggaacatcaagttttgaaatcttt |
2626582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University