View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_low_29 (Length: 248)
Name: NF4168_low_29
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 18894362 - 18894236
Alignment:
| Q |
18 |
aaggatggaacacgtaaattgtactaaaatatatagtacaacaagtactaaataccgagtaagctttcgtcatcaatcttgaaagaggttgttagattcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18894362 |
aaggatggaacacgtaaattgtactaaaatatatagtacaacaagtactaaataccgagtaagctttcgtcatcaatcttgaaagaggttgttagatttg |
18894263 |
T |
 |
| Q |
118 |
atttgtaaattgtatgtctttgaagca |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
18894262 |
atttgtaaattgtatgtctttgaagca |
18894236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 176 - 248
Target Start/End: Complemental strand, 18894119 - 18894047
Alignment:
| Q |
176 |
cactattgaagaaaatatatttttattcataatgatgttagcttttctttggcttcaattttattatttccac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18894119 |
cactattgaagaaaatatatttttattcataatgatgttagcttttctttggcttcaagtttattatttccac |
18894047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University