View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_low_31 (Length: 239)
Name: NF4168_low_31
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_low_31 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 45229215 - 45229436
Alignment:
| Q |
18 |
gttatcgcttccttcgctcttactcttttccgatccaaaacgtctcggcatcgctctcatcctcaaggcatttcccttgtttgatttcatcaccattgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229215 |
gttatcgcttccttcgctcttactcttttccgatccaaaacgtctgggcatcgctctcatcctcaaggcatttcccttgtttgatttcatcaccattgag |
45229314 |
T |
|
| Q |
118 |
gtatgtgaatacttgtctctactctcttgtttggaaaagaattatgagtctgcattcaaattttaagtaattatttgtgaatatgtatgaatagcttatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45229315 |
gtatgtgaatacttgtctctactctcttgtttggaaaagaattatgagtctgcattcaaattttaagtaattatatgtgaatatgtatgaatagcttatt |
45229414 |
T |
|
| Q |
218 |
tgcagcttatagtacatgataa |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45229415 |
tgcagcttatagtacatgataa |
45229436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University