View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4168_low_39 (Length: 223)
Name: NF4168_low_39
Description: NF4168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4168_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 38348212 - 38348429
Alignment:
| Q |
1 |
cttcctatttctttctattcttacaaatagtgttaaaatgaaagcacatgactttcttgcaccttctcttttttctttctcctttgagttaggtttagat |
100 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348212 |
cttcctagttctttctatgcttacaaatagtgttaaaatgaaagcacatgactttcttgcaccttctcttttttctttctcctttgagttaggtttagat |
38348311 |
T |
 |
| Q |
101 |
acctgaatctattctctttttcattctttgtgctacaataggtatttattttctacttcttttgacac-nnnnnnnnnnnccatataaacctagagagag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38348312 |
acctgaatctattctctttttcattctttgtgctacaataggtatttattttctacttcttttgacacacaaaaaaaaaaccatataaacctagagagag |
38348411 |
T |
 |
| Q |
200 |
tgaagttgatgcataact |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38348412 |
tgaagttgatgcataact |
38348429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University