View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4169_low_10 (Length: 227)
Name: NF4169_low_10
Description: NF4169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4169_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 12508430 - 12508638
Alignment:
| Q |
19 |
aatactttgaagattcttgctcaattttgctttcaatgaagcaaaagttaaactgttttttgcttcatttgtttgtggtgatgatactaatccttgatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12508430 |
aatactttgaagattcttgctcaattttgctttcaatgaagcaaaagttaaactgttttttgcttcatttgtttgtggtgatgatactaatccttgatca |
12508529 |
T |
 |
| Q |
119 |
tcactgcatggtgttgtaccgtctgttgatactgctagggcgaagttggttcgagcattttctccgcgtaaagctcgagcagcttcgtcgtaagctcgag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12508530 |
tcactgcatggtgttgtaccgtctgttgatactgctagggcgaagttggttcgagcattttctccgcgtaaagctcgagcagcttcgtcgtaagctcgag |
12508629 |
T |
 |
| Q |
219 |
cagcttctt |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
12508630 |
cagcttctt |
12508638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University