View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4169_low_11 (Length: 209)
Name: NF4169_low_11
Description: NF4169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4169_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 5416126 - 5416294
Alignment:
| Q |
16 |
agaagaagaattttagtgctaactttgtacttaattgggtctcagaacagtgtaccttagctatagtttaaactccaagaaaatatacactattcactaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5416126 |
agaagaagaattttagtgctaactttgtacttaattgggtctcagaacagtgtaccttagctatattttaaactccaagaaaatatacactattcactaa |
5416225 |
T |
 |
| Q |
116 |
taatgtatcatatttcaacttttttaaaaaagttgtttaaaataaatgtaagtaaagtgagagaataagatctttc |
191 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
5416226 |
taatgtatcatatttcaactttttaaaaaaagttgtt-------aatgtaagtaaagtgagataataagatctttc |
5416294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 74
Target Start/End: Original strand, 5433867 - 5433921
Alignment:
| Q |
20 |
gaagaattttagtgctaactttgtacttaattgggtctcagaacagtgtacctta |
74 |
Q |
| |
|
|||||| |||||||||||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
5433867 |
gaagaactttagtgctaactttgaacttaacgtggtctcagaacaatgtacctta |
5433921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University