View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4170_low_11 (Length: 237)
Name: NF4170_low_11
Description: NF4170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4170_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43669887 - 43669665
Alignment:
| Q |
1 |
attcctaattcaagttgttccaata---tatcacaaaatatcaggactatataataatagatcaacaatgaaataaaaattattttcaaattgttgtcaa |
97 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669887 |
attcctaattcaagttgttccagtagtatatcacaaa-tatcaggactatataataatagatcaacaatgaaataaaaattattttcaaattgttgtcaa |
43669789 |
T |
 |
| Q |
98 |
aaaatttatttagagatttttgtgatactactatctttagtataannnnnnnnagtctgaaaaggcatgaaactcacgcaatagcatctttggttttgcg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669788 |
aaaatttatttagagatttttgtgatactactatctttagtataattttttttagtctgaaaaagcatgaaactcacgcaatagcatctttggttttgcg |
43669689 |
T |
 |
| Q |
198 |
gtgatcgtcattatagcttcaaag |
221 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
43669688 |
gtgatcgttattatagcttcaaag |
43669665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University