View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4170_low_9 (Length: 244)
Name: NF4170_low_9
Description: NF4170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4170_low_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 25 - 244
Target Start/End: Original strand, 33948404 - 33948623
Alignment:
| Q |
25 |
acaataacaacatgtctgaaacaaagatcaataccttaaacgaaccaatgatttccaaagacatggaaaatcaaagagacatcatagttagtgaaacaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948404 |
acaataacaacatgtctgaaacaaagatcaataccttaaacgaaccaatgatttccaaagacatggaaaatcaaagagacatcatagttagtgaaacaaa |
33948503 |
T |
 |
| Q |
125 |
atctctattatcattagctttaccaacagcactaacagcactaatcttctatgcacgttccatgatatctatgatgtttcttggtaaacttggtgatgtg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948504 |
atctctattatcattagctttaccaacagcactaacagcactaatcttctatgcacgttccatgatatctatgatgtttcttggtaaacttggtgatgtg |
33948603 |
T |
 |
| Q |
225 |
gaacttgcatcaggttcatt |
244 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33948604 |
gaacttgcatcaggttcatt |
33948623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University