View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4171_high_14 (Length: 232)
Name: NF4171_high_14
Description: NF4171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4171_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 51430606 - 51430741
Alignment:
| Q |
1 |
ccctcttctcattgtaaccagcttctccaggaacaagattcttagtgacaagagcatcttctttacccttggcaatgaaaatcccctcatgtctatgagg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51430606 |
ccctcttctcattgtaaacagcttctccaggaacaagattcttagtgacaagagcatcttctttacccttggcaatgaaaataccctcatgtctatgagg |
51430705 |
T |
 |
| Q |
101 |
ttcaacaatgaccttgctacctcccttcatgccacc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51430706 |
ttcaacaatgaccttgctacctcccttcatgccacc |
51430741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 3 - 136
Target Start/End: Complemental strand, 17128515 - 17128382
Alignment:
| Q |
3 |
ctcttctcattgtaaccagcttctccaggaacaagattcttagtgacaagagcatcttctttacccttggcaatgaaaatcccctcatgtctatgaggtt |
102 |
Q |
| |
|
||||||||||| ||| |||| || |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| || || ||||||||||| | |
|
|
| T |
17128515 |
ctcttctcattataaacagcctcaccaggaacaagattcttagtaacaagagcatcttctttacccttagcaatgaaaataccttcgtgtctatgaggct |
17128416 |
T |
 |
| Q |
103 |
caacaatgaccttgctacctcccttcatgccacc |
136 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| |
|
|
| T |
17128415 |
caacaacaaccttgctacctcctttcattccacc |
17128382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University