View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4171_high_16 (Length: 202)

Name: NF4171_high_16
Description: NF4171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4171_high_16
NF4171_high_16
[»] chr7 (1 HSPs)
chr7 (19-190)||(48669170-48669341)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 48669341 - 48669170
Alignment:
19 cattcttcatcttcatctgttgattgcaattggagttggagatgggtcatcctcgtttccattcttgttcgcaaattcatctctttctttgctattccta 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48669341 cattcttcatcttcatctgttgattgcaattggagttggagatgggtcatcctcgtttccattcttgttcgcaaattcatctctttctttgctattccta 48669242  T
119 tctactggactggcttctttcttgattttttcctcaatcttctttccctgaacggtgcttccttctctgctc 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||    
48669241 tctactggactggcttctttcttgattttttcctcaatcttctttcccttaacggtgcttccttctttgctc 48669170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University