View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4171_high_9 (Length: 274)
Name: NF4171_high_9
Description: NF4171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4171_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 21286733 - 21286963
Alignment:
| Q |
17 |
tcaatcattgtacgcctcgcatcatgagcatcaagcatgttctccatacacatacgcatctcagctatggaatcaagtacggcttgcaagccaaccggat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21286733 |
tcaatcattgtacgcctcgcatcatgagcatcaagcatgttctccatacacatacgcatctcagctatggaatcaagtacggcttgcaagccaaccggat |
21286832 |
T |
|
| Q |
117 |
gagcataatcaggatcatcatcttcactttcagtttcaccaatcacttcatcatcacctgcaacaacacccctcccctcatccattgcagcctgcacctc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21286833 |
gagcataatcaggatcatcatcttcactttcagcttcaccaatcacttcatcatcacctg---caacacccctcccctcatccattgcagcctgcacctc |
21286929 |
T |
|
| Q |
217 |
atcaaccaaaatctcaccagtagaaacatagaca |
250 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
21286930 |
atcaaccaaaatctcaccagcagaaacatagaca |
21286963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University