View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4171_low_12 (Length: 286)
Name: NF4171_low_12
Description: NF4171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4171_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 270
Target Start/End: Original strand, 41417717 - 41417976
Alignment:
| Q |
13 |
gaaacaacccaccctcaataattaaaaaaggacacaagcaaggaaatta-cattcacataaaa-agaaagaaagaaatcatcgaggaattcaataataca |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
41417717 |
gaaacaatccaccctcaataattaaaaaaggacacaagaaaggaaattaacattcacataaaataaaaagaaagaaatcatcgaggaattcaataataca |
41417816 |
T |
|
| Q |
111 |
caatttcaaatttcatttcccatctagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagagaacctcatagacaagtccagcaattccac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41417817 |
gaatttcaaatttcatttcccatctagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagagaacctcatagacaagtccagcaattccac |
41417916 |
T |
|
| Q |
211 |
caccgataagtgggccagcccagtagacccagtggttggaccagctccagctcacaacag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41417917 |
caccgataagtgggccagcccagtagacccagtggttggaccagctccagctcacaacag |
41417976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University