View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4171_low_13 (Length: 277)
Name: NF4171_low_13
Description: NF4171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4171_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 155
Target Start/End: Complemental strand, 1776248 - 1776110
Alignment:
| Q |
19 |
acaaactctatatatgtctctaactaattccagagtgtcg---ctgtattaaaaaa-cttgatggagttcataaacgagatatactattannnnnnnnat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
1776248 |
acaaactctatatatgtctctaactaattacagagtgtcgaagctgtattaaaaaaacttgatggagttcataaacgagatatactatt--tttttttat |
1776151 |
T |
|
| Q |
115 |
gctaaacgagatataatagacacaaactataaaatttcttc |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1776150 |
gctaaacgagatataatagacacaaactataaaatttcttc |
1776110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 198 - 266
Target Start/End: Complemental strand, 1776065 - 1775997
Alignment:
| Q |
198 |
tgggaaagaacatttatatgcaatttactagatgcatttatcattttttcccctctaaacatacccttt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1776065 |
tgggaaagaacatttatatgcaatttactagatgcatttatcattttttcccctctaaacatacccttt |
1775997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University