View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4171_low_24 (Length: 202)
Name: NF4171_low_24
Description: NF4171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4171_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 48669341 - 48669170
Alignment:
| Q |
19 |
cattcttcatcttcatctgttgattgcaattggagttggagatgggtcatcctcgtttccattcttgttcgcaaattcatctctttctttgctattccta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669341 |
cattcttcatcttcatctgttgattgcaattggagttggagatgggtcatcctcgtttccattcttgttcgcaaattcatctctttctttgctattccta |
48669242 |
T |
 |
| Q |
119 |
tctactggactggcttctttcttgattttttcctcaatcttctttccctgaacggtgcttccttctctgctc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
48669241 |
tctactggactggcttctttcttgattttttcctcaatcttctttcccttaacggtgcttccttctttgctc |
48669170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University