View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4172_high_9 (Length: 348)
Name: NF4172_high_9
Description: NF4172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4172_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 333
Target Start/End: Original strand, 2627639 - 2627964
Alignment:
| Q |
17 |
tcattcccatccaactcgtgaagacagtattgttcactctttcagcgatgatccagtcgagcaatcatgtccactcatgacacactgctgcaccacatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627639 |
tcattcccatccaactcgtgaagacagtattgttcactctttcagcgatgatccggtcgagcaatcatgtccactcatgacacactgctgcaccacatga |
2627738 |
T |
|
| Q |
117 |
acatacctctgcattactacgcaagacaataatctccctccatctttcttctgcatccttgtgctttaccagtgccttttttatgtgataaggtgttgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627739 |
acatacctctgcattactacgcaagacaataatctccctccatctttcttctgcatccttgtgctttaccagtgccttttttatgtgataaggtgttgtt |
2627838 |
T |
|
| Q |
217 |
ttcacagcataaa---------ctctannnnnnnnnnnnnaatagctaaacttttattgaaaacacttgagcacaaactgcgcttgagattgaagataca |
307 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627839 |
ttcacagcataaaaaattctacctctattttttgttttttaatagctaaacttttattgaaaacacttgagcacaaactgcgcttgagattgaagataca |
2627938 |
T |
|
| Q |
308 |
aataaaattctgaatagcagaaaaac |
333 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2627939 |
aataaaattctgaatagcagaaaaac |
2627964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University